Neuroscience

Neuroprotective effect of Sirt2-specific inhibitor AK-7 against acute cerebral ischemia is P38 activation-dependent in mice
Danhong Wu, Wenmei Lu, Zhenyu Wei, Ming Xu, Xueyuan Liu PII: S0306-4522(18)30070-8
Reference: NSC 18263

To appear in: Neuroscience
Received Date: 26 September 2017
Accepted Date: 18 January 2018

Neuroprotective effect of Sirt2-specific inhibitor AK-7 against acute cerebral ischemia is P38 activation-dependent in mice
Danhong WuG1, 2, 4, Wenmei LuG2, 3, Zhenyu Wei3, Ming Xu2*, Xueyuan Liu1, 5*

1.Department of Neurology, The Affiliated Shanghai NO.10 People’s Hospital，Nanjing Medical University, 301 Yanchang Road, Shanghai, China 200072
2.Department of Oncology, Shanghai 9th People’s Hospital, Shanghai Jiao Tong University School of Medicine, 280 Mohe Road, Shanghai, China 201999
3.Department of Neurology, Shanghai 9th People’s Hospital, Shanghai Jiao Tong University School of Medicine, 280 Mohe Road, Shanghai, China 201999
4.Department of Neurology, Shanghai Fifth People’s Hospital, Fudan University, 801 Heqing Road, Shanghai, China 200240
5.Department of Neurology, Shanghai Tenth People’s Hospital of Tongji University, 301 Yanchang Road, Shanghai, China 200072
G these authors contribute equally for this work
To whom corresponding should be addressed

Ming Xu
Department of Oncology, Shanghai 9th People’s Hospital Shanghai Jiao Tong University School of Medicine
280 Mohe Road, Shanghai, China Tel: +86-21-56691101-6950
E-mail: [email protected] or
Xueyuan Liu
Department of Neurology, The Affiliated Shanghai NO.10 People’s Hospital Nanjing Medical University
301 Yanchang Road, Shanghai, China 200072
Tel: +86-135-6457-8127
E-mail: [email protected]

Abbreviation

NAD+: nicotinamide adenine dinucleotide ACI: acute cerebral ischemia
rt-PA: recombinant tissue plasminogen activator MCAO: middle cerebral artery occlusion
AK-7: 3-(1-azepanylsulfonyl)-N-(3-bromphenyl) benzamide DMSO: dimethyl sulphoxide
CD: clinical deterioration
ICR: institute of cancer research
TTC: 2,3,5-triphenyltetra-zolium chloride FBS: fetal bovine serum
MRI: magnetic resonance imaging CT: computerized tomography ECL: enhanced chemiluminescence

Abstract

Cerebral ischemic is the most common cause of stroke with high morbidity, disability and mortality. Sirtuin-2 (Sirt2), a vitally important NAD+-dependent deacetylase which has been widely researched in central nervous system diseases, has also been identified as a promising treatment target by using its specific inhibitors such as AK-7. In this study, we found that P38 was specifically activated after focal cerebral ischemia injury, and it was also significantly activated after AK-7 administration in a concentration-dependent manner in vitro and in vivo. AK-7 decreased the infarction volume remarkably and promoted the recovery of neurological function efficiently in the mice evaluated by behavior tests. In contrast, pP38 inhibition increased the infarct volume and exacerbated the symptoms of paralysis. Herein, we suggest AK-7 improves the outcome of brain ischemia in dependence on the P38 activation in mice, which may serve as a strategy for the treatment of stroke.

Keywords: acute cerebral ischemia, AK-7, Sirt2, P38, stroke

Introduction

Stroke is the third life-threatening condition following coronary heart disease and cancer in most western countries (Ng et al., 2014, Feigin et al., 2015). Acute cerebral ischemia (ACI) is a type of stroke that leads to a sudden onset of focal central neurological deficit in humans or animals with serious clinical symptoms, including paralysis, aphasia, visual disorders, coma and brain tissue necrosis (Yoshimoto and Kwak, 1995, Guo et al., 2012). This serious wide spread condition causes health and labor loss, and pose a threat to the development of many countries (Ankolekar et al., 2012, Neuhaus et al., 2014, Maysami et al., 2015). The pathogenesis of ACI is extremely complex. Generally, luminal stenosis or occlusion of the cerebral artery caused by atherosclerosis and thrombosis could easily lead to ACI. Additionally, the abnormal presence of solid, liquid, or gaseous objects through the blood circulation into the cerebral and neck arteries could also lead to a sudden reduction or blockage of the blood flow (Hamann, 1997, Egelhof et al., 1998, Lee et al., 2006). The current clinical guidelines usually recommend the selective application of thrombolytic therapy, mechanical thrombectomy and appropriate anti-coagulation for the treatment of patients with acute ischemic stroke. Recombinant tissue plasminogen activator (rt-PA), aspirin or clopidogrel are commonly used drugs for clinical purpose. However, serious negative impact and poor outcomes still occur on stroke patients using the present therapeutic methods. The recanalization rate of major artery occlusion was ranged from 10% to 25% accompanied with considerable clinical deterioration (CD) (from 12% to 16%). Hemorrhagic transformation was found in 5% to 10% patients with major artery occlusion, which is the most common complication (Grotta et al., 2001, 2006, Saqqur et al., 2007). Additionally, the favorable neurological outcome of mechanical thrombectomy was approximately 57.9%, with a mortality rate of 6.9%, procedure and device related severe adverse events rate of 7.4%, intracranial hemorrhagic transformation rate of 18.8% (Shi et al., 2010, Pereira et al., 2013). Thus, stroke patients having the above mentioned features should seek a highly efficient therapeutic strategy in order to improve outcomes and help prevent the adverse complications.

of Huntington’s disease (Chopra et al., 2012), Parkinson’s disease (Chen et al., 2015b), and Alzheimer’s disease (Biella et al., 2016). In neuronal cells, AK-7 can significantly enhance the level of lysine40 (K40) acetylated α-tubulin, a typical substrate of Sirt2, which controls the neuronal motility and proliferation of non-neuronal cells (North et al., 2003, Blander and Guarente, 2004, Pandithage et al., 2008). Importantly, Sirt2 inhibition had been demonstrated to protect the brain from damage caused by stress (Luthi-Carter et al., 2010, Li et al., 2013, Chen et al., 2015b). In neurological disorders, Sirt2 was proved to be essential for lipopolysaccharide-induced microglia activation and might be a therapeutic target for the inhibition of inflammatory responses (Chen et al., 2015a). The finding was intriguingly at odds with the pharmacological down-regulation of Sirt2 exacerbated traumatic brain injury by regulating NF-kB p65 acetylation that showed contradictory effect of Sirt2 in brain disorders (Yuan et al., 2016). Cerebral ischemia injury, inflammation and oxidative stress share the common pathogenesis mechanisms in such aspect as neurodegenerative diseases. Whereas it remains unclear whether Sirt2 relieves or exacerbates cerebral ischemia injury, and there are few studies regarding the participation of AK-7 in the pathogenesis of cerebral infarction.

In this study, we experimentally demonstrated the effects of AK-7 in a mouse model of middle cerebral artery occlusion (MCAO) and revealed that P38 (Mitogen-Activated Protein Kinase) activation was required for the brain-protective role of AK-7 in ACI in vitro and in vivo, which thus deserved attention as a possible therapeutic strategy for stroke patients.
Materials and methods

Animals and experimental group

Adult male ICR mice, provided by Shanghai Laboratory Animal Corporation (SLAC), Shanghai, China, were prepared for surgery. The mice were raised under

conditions of diurnal lighting and provided with food and water ad libitum. AK-7 (Sigma Aldrich, USA) was injected intraperitoneally in a mixed solvent containing 25% Cremophor EL and 10% DMSO (Sigma Aldrich, USA) as described previously (Chopra et al., 2012, Yuan et al., 2016). Sirt2 inhibitor was given to the mice three times in total: 30 min before surgery, 6 h and 24 h after surgery (Liu et al., 2014). AK-7 was initially tested at 10 and 20 mg/kg to determine the dosage that had beneficial influence on mice without evident side effects. LY2228820 (Selleck Chemical LLC, USA), an effective pP38 inhibitor, was combination with AK-7 before and after MCAO. Behavior tests were conducted three days after MCAO. The mice were sacrificed immediately after behavior tests for performing further tests as described below. The total 150 mice were prepared for the experiment initially and were randomly divided into three or four groups (Tesio et al., 2015, Lalaoui et al., 2016). The survival mice and the mortality statistics were summarized in Table 1 and Table 2 respectively.

Cell culture and treatment

Neuro-2a, HEK293T and SH-SY5Y cells were cultured in Dulbecco’s modified Eagle’s medium (Hyclone, USA) containing 10% FBS (BioWest, USA) and 100 U/mL penicillin/streptomycin under conditions of 5% CO2 and humidified air at 37°C. The cells were treated with AK-7 that is dissolved in DMSO on concentration gradients (0, 5, 10, 20 µmol/mL). Forty-eight hours after the application of the medicine, the cells were lysed in 2% SDS lysis buffer. The protein concentration of resulting cell lysate was quantified by NanoDrop2000 (Thermo Scientific, USA) for SDS-PAGE and Western blot analysis. Cell transfection was performed as the description of the Hieff TransTM Liposomal Transfection Reagent (#40802ES08, YEASEN, China). The shRNA oligos targeting human Sirt2 were ordered from Genewiz Company of China and the forward and reverse oligos sequence was showed as follows (forward: 5’-GATCCGCCAACCATCTGTCACTACTTCTCGAGAAGTAGTGACAGATGGT
TGGCTTTTTG-3’, reverse:
5’-AATTCAAAAAGCCAACCATCTGTCACTACTTCTCGAGAAGTAGTGACAG

ATGGTTGGCG-3’). The oligos were annealed and cloned into pGreenpuro-shRNA vector for generating recombinant lentivirus in HEK293T cells together with pCMV-dR8 and pMD2.G plasmids. Further, the recombinant lentivirus was used to infect Neuro-2a or SH-SY5Y cells for screening the Sirt2-silenced stable cell line under the pressure of 10 ng/ml puromycin.

MCAO model

Adult male ICR mice were anesthetized with amobarbital sodium (80 mg/kg) by intraperitoneal injection. Surgery was performed by transient left MCAO followed by reperfusion as described previously with a slight modification (Hara et al., 1996, Verma et al., 2014). A cervical median incision was made to expose the carotid artery, followed by isolation of the left common carotid artery, the internal artery, and the external artery from the proximal connective tissue to provide a clear operating field. The nylon monofilament coated with silica gel was guided from the external carotid artery into the internal artery to occlude the middle cerebral artery (MCA) (Bouët et al., 2007, Li et al., 2007). The gel-coated nylon filament, whose diameter matched the inner diameter of MCA, was introduced until an obstacle was encountered. Ninety minutes after the occlusion, the mice were anesthetized once again to remove the nylon for efficient recanalization. During surgery, a heated pad was used to maintain the core temperature of mice at 37°C. The mice were then carefully taken back to the cage where they were provided with food and water as needed.

Behavior tests

Elevated body swing test (EBST). This test was conducted after MCAO to determine the behavior function (Borlongan and Sanberg, 1995, Ingberg et al., 2015). To obtain credible results, the mice were trained three days before surgery. Three days after MCAO, the mice were placed into a transparent box and allowed to calm down. Then, each experimental mouse was picked up by the base of its tail and hanged 10 cm above the box so that its body was positioned along the vertical axis. Further, the number of body swing was recorded when the mouse bent the upper body forward the vertical axis at an angle greater than 10° to the plain of either side. To differentiate

each separate swing, we ensured the animal returned to its original position before another swing. This procedure was repeated 10 times.
Corner test. The corner test was performed using the methodology reported by Zhang et al (Zhang et al., 2002). Two boards with dimensions of 30×20×1 cm3 were placed at an angle of 30°, and their edges were separated by a small opening along the joint to encourage the mouse to enter the corner. The experimental mouse was positioned between the two boards, facing the corner, half-way before the joint. When the mouse entered deeply into the corner, its vibrissae had to be stimulated bilaterally by the cardboard sheets, causing the animal to rear forward and upward, and finally to turn around and face the open end of the boards (the entering direction). The number of times of mouse turning right or left was recorded. This test was taken ten times. As described previously the effective turning was scored when the mouse was in a face-back position with its forepaws stretched up to one of the boards instead of bowing its head.
Pole test. The pole test was carried out as described before with a minor modification
(Ogawa et al., 1985, Matsuura et al., 1997). The mouse was placed on the top of a vertical pole with a rough surface with a diameter of 8mm and a height of 55cm. The mouse was carefully placed on the pole so that its head was maintained in the upward direction, and the time until the point when it turned downward to descend to the floor was recorded. This test was recorded with a maximum of 120s. If the mouse descended part way and fell the rest of the way, the behavior was scored until it reached the ground. When the mouse could not turn in the reverse direction and dropped off the pole, 120s was recorded because it was the maximum time limit for the test.
Beam balance test. The beam balance test is an efficient approach or assessment of the neuroethological function in different brain injury models (Feeney et al., 1982, Takata et al., 2006). In this test of our study, the rater was blind to the experiment. The beam-balancing task consisted of placing both the fore limbs and the hind limbs of the mouse on a narrow wooden beam (with a diameter of 25 mm, a length of 122 cm and a height of 42cm) to evaluate its sensorimotor skills. The beam was placed in darkness with a bright light in one direction to stimulate the mouse to move through

the beam. The evaluation of the results of the beam balance test was performed based on a score within the range of 0–6 according to the following criteria: 0=able to through the bar normally, 1=could traverse the beam with affected hind limb slipping off one time, 2=could traverse the beam with affected hind limb slipping rate>50%; 3=could traverse the beam with affected hind limb slipping rate<50%; 4=could not traverse the bar within 90s but could stay with balance; 5=able to keep balance in the beam but do not move; 6=fell off the bar immediately.
Neurological score (score 0–5). Behavioral score is a simple and convenient method of evaluation widely used to assess the behavior deficiency in brain injury models, especially in mouse MCAO models. We conducted this test as described before with a slight modification (Bederson et al., 1986, Hara et al., 1996, Hattori et al., 2000). Evaluation was performed three days after the operation according to the following criteria: 0=normal behavior without any sign of deficiency; 1=the mouse could not straighten its contralateral forepaws, when the mouse was suspended by its tail, the mouse turn contralateral field; 2=the mouse ran around for the off side of the occluded hemisphere when it move; 3=the mouse skewed even though it was still; 4=the mouse could not move autonomously.

TTC staining

Three days post-surgery, peritoneal anesthesia was applied until deep coma of the mouse was achieved. Then, the thoracic cavity was opened to expose its heart, and normal saline was perfused by the left ventricular with an injector. The water was discharged by an incision in the right atrium. After heart perfusion, the brain was taken out carefully and cut into 1-cm-thick slices with a brain slices mold. 2,3,5-Triphenyltetra-zolium chloride（TTC）(Sigma Aldrich, USA) was dissolved in PBS to obtain a 2% solution. The slices of brain tissue were immersed in 2% TTC solution for 30 min at 37°C in the dark (Calloni et al., 2010). Next, we determined the infarct brain tissue by its resistance to the stain, whereas the survival tissue was colored in red.

Western blot analysis

Samples of cell and brain lysate were extracted by lysis buffer containing of 50 mM Tris-HCl (pH7.4), 150 mM NaCl, and 2% SDS. Next, the supernatant from the protein extraction was quantified by NanoDrop2000. Equal amounts of proteins were loaded for electrophoresis on 10% SDS-PAGE (10% Acryl/Bis solution, 0.375M Tris-HCL (pH8.8), 0.1% SDS, 1.18% ammonium persulfate, 0.75% TEMED) and then transferred to a 0.45µm-filter PVDF membrane. Further, the membrane was blocked with 5% non-fat milk and incubated with primary antibodies at 4°C overnight. The membrane was next immersed in the appropriate HRP-conjugated secondary antibody for at least 30 min. Finally, the target bands were detected by enhanced chemiluminescence (ECL) using the Fusion FX7 system (VILBER, French). The primary antibodies used in our investigation were as follows: Sirt2 antibody (#ab67299, abcam, USA), pP38 antibody (#4511␀, CST, USA), P38 antibody (#A0227, Abclonal, China), β-tubulin antibody (#HC101, TransGen Biotech, China), pERK antibody (#4370, CST, USA), pAKT antibody (#4058, CST, USA).

Statistical Analysis

All experiments were reproduced in triplicate. All values were presented as the mean ± standard error of the mean (SEM). Quantitative data were analyzed using GraphPad Prism 5.0 (GraphPad Software Inc., USA), with Student’s t test or one-way analysis of variance (ANOVA). A value of p < 0.05 was considered as statistical significance.
Results

P38 signal is specifically activated after acute focal cerebral ischemia

MCA supplies blood to a part of the brain, including the lateral surface of the cerebral hemisphere and its brain alba. A blockage of the artery providing blood to the striatum might lead to the death of brain tissue cells, which was indicated by the appearance of a red color resistance after staining with TTC. Thus, in case of MCAO, the area of white infarction can be identified by TTC staining (Figure 1A). Different stimuli are involved in the pathophysiological processes of stroke or cardiovascular

diseases, which stimulate ERK1/2, p38 and NF-kB in cells (Nguyen et al., 2013, Yang et al., 2017). Believing that, we separated the mouse striatum and cortex for further examinations. By using immune-blotting, we found that P38 signal was specifically activated in the ischemic hemisphere in contrast to the normal side, especially in the striatum (Figure 1B), whereas ERK, or AKT signal was not activated obviously as detected by immune-blotting with pERK or pAKT (Figure 1B). To assure the pP38 activation in responding to ACI, 6 brain tissue samples were collected for the western-blot detection and quantification (Figure 1B&C). The results showed pP38 activation was statistically significant in the brain when mice were suffered from the ischemic injury (Figure 1C). The obtained evidence revealed that the level of pP38 might be involved in the response to ischemia. Thus, we assumed that P38 activation probably exerts an associate effect in the infarction area by counteracting or promoting the ischemic injury.

AK-7 protects mice against the ischemic injury and neurological dysfunction

To identify the effect of AK-7 in ACI, the mice were sacrificed to determine their ischemic volume at three days post-surgery. After anesthesia, mouse brains were carefully and rapidly removed and cut into 1-cm-thick fresh brain slices which were immediately immersed in TTC solution to detect the infarction area. As expected, the infarction volume was remarkably decreased in the subset systematically treated with AK-7 (Figure 2A). The mortality of surgical mice was decreased by AK-7 in a concentration-dependent manner (Table 2). The area of the ischemic infarction was smaller in the group of animals in which AK-7 was administered than those in the control. Furthermore, brain infarction volume of group given AK-7 at the dose of 20 mg/kg was substantially reduced than the group treated with a dose of 10 mg/kg (Figure 2A). On the third day after MCAO, the behavior tests were performed including the EBST, pole test, corner test, neurological score test, and beam balance test. Before MCAO, mice did not show behavior asymmetries on the elevated body swing test (the left turn 5.16±0.11), pole test (6.21±0.15) and corner test (the left turn 4.85±0.11). The results from these five examinations indicated that the application of AK-7 significantly attenuated the paralysis of the mice after the one-side blockage of

MCA, and mice behavior was vastly improved in the group of mice in which 20 mg/kg of AK-7 was administered compared with that of control with a statistically significant difference (P<0.01) (Figure 2B-F). The EBST, pole test and beam balance test indicated that the administration of 10 mg/kg of AK-7 was also beneficial to the mice with infarction condition. Statistically significant difference was observed in comparison to the group of mice in which no AK-7 was applied (Figure 2B-C, F). Together, the results indicated that AK-7 is able to protect mice from ischemic injury by decreasing the infarction volume and modifying the neurological function.

AK-7 enhances the pP38 activity in vitro and in vivo

To analyze the association between AK-7 and pP38 activity, the in vitro culture of Neuro-2a cells treated with different concentrations of AK-7 (0, 5, 10, 20 µM) were collected respectively and lysed for western-blot analysis. The result indicated that AK-7 was able to induce a significant up-regulation of P38 activity in a concentration-dependent manner (Figure 3A). Similarly，P38 was obviously activated after silencing Sirt2 gene in Neuro-2a or SH-SY5Y cells (Figure 3B), which indicated that Sirt2 protein may have impacts on the P38-MAPK signal transduction. In vivo, the striatum of the ischemic and normal hemisphere were collected and lysed respectively for western-blot analysis. Expectedly, the pP38 expression was
maintained at the same level without obvious changes in the sham-operated group (Figure 3C). But the expression level of pP38 was significantly activated in mice treated with AK-7 in contrast to those in control and it was higher in the mice group treated with 20 mg/kg of AK-7 than that with 10 mg/kg of AK-7, especially in the ischemic hemisphere (Figure 3C). However, 10mg/kg of AK-7 did not perfectly enhance the pP38 level in the mouse comparing to the control, which probably was due to the individual variables in this trail. Taken together, these findings suggested AK-7 can enhance the pP38 activity both in vitro and in vivo.

Neuroprotective effect of AK-7 relies on the activation of pP38

To examine the function of enhanced pP38 activity and whether it affects the neuroprotective effect of AK-7, the combination of equal concentrations (20 mg/kg)of the pP38 inhibitor LY2228820 and AK-7 was applied to the mice. The expression of pP38 in the ischemic striatum was considerably down-regulated after the application of LY2228820 (Figure 3C). The TTC staining results revealed that the infarction area was reduced in the mice group in which AK-7 was applied, whereas the area of the infarction was larger after the application of the combination of AK-7 and LY2228820 than that of AK-7 alone (Figure 4A). Similarly, the pP38 inhibitor reduced the effect of AK-7 and increased the mortality of MCAO mice (Table 2). The results from the five behavior tests confirmed the positive effect of AK-7 with the promotion of beneficial changes in the behavior function of mice harboring acute unilateral focal ischemia (Figure 4B-F). As expected, the impact of the pP38 inhibitor (LY2228820) had the reverse effect on the protective function of AK-7 when the combination of both (AK-7 and LY2228820) was applied (Figure 4B-F), consistent with its negative effect on the infarction volume (Figure 4A). All together, we provided evidences suggesting that AK-7 had a therapeutic potential against brain ischemia. Moreover, specifically activated pP38 after acute cerebral ischemia is beneficial to the protective function of AK-7.

Discussion

Acute ischemia stroke is a medical emergency with high morbidity and mortality. Given that it has serious outcome and frequently leads to insufficient therapy, many experimental and clinical studies have been carried out to examine a new sufficient treatment for stroke. Based on previous studies, rt-PA intravenous thrombolysis, mechanical thrombectomy and combined intravenous and intra-arterial recanalization are proved to be beneficial for stroke patient by evaluating the National Institutes of Health Stroke Scale (NHISS) scores, CD and infarction area using magnetic resonance imaging (MRI) or computerized tomography (CT) (Grotta et al., 2001, Gralla et al., 2006, Kent et al., 2006, Nezu et al., 2011). According to the large sample randomized controlled clinical trials, immediate treatment with rt-PA shorter than 4.5h from the onset of disorder was beneficial to patients with acute ischemic stroke. Mechanical thrombectomy was beneficial in time window shorter than 6h according to clinical guideline (del Zoppo, 1990). Although intravenous rt-PA

thrombolysis and mechanical thrombectomy improved the blank and outcomes of patients in the treatment of acute ischemic stroke, recanalization rate was still low with high disability rate and fatality rate (Saqqur et al., 2007, Shi et al., 2010).

Our study suggested that acute ischemia induced pronounced activation of P38 in the ischemic hemisphere and pP38 was closely related to the protective effect of AK-7 against acute ischemic stroke in mice. In previous investigations, both of the mRNA and protein level of Sirt2 can be induced after cerebral ischemia, whereas the expression of the major cytoplasmic isoform (SIRTv2) was reduced when compared with untreated wild-type control mice, the longer v1-isoform (SIRTv1) was induced in both ischemic and non-ischemic brain hemispheres when compared with untreated wild-type mice (Krey et al., 2015). As such, we neither observed a distinguishable change of Sirt2 protein level between ischemic and non-ischemic hemispheres (Figure 1B). Meanwhile, AK-7 did not alter the protein level of Sirt2, but only impairs its deacetylation activity (Figure 1B and Figure 3C), which was in consistent with the previous reports (Krey et al., 2015, Chen et al., 2015b). However, the pP38 was significantly enhanced in the ischemic hemisphere and increasingly activated in a concentration-dependent manner by the systematic administration of AK-7 (Figure 1B&C and Figure 3C). To our knowledge, p38 activation was happening once the mouse suffered ischemic injury in brain. According to the results of TTC staining and behavior tests (Figure 2 and Figure 4), we deduced that the responded pP38 is beneficial for mice suffering acute cerebral injury, and AK-7 to some extent can enhance the pP38 activity to enlarge the protective effect of pP38 by suppressing Sirt2 activity, which hints that Sirt2 may have a negative effect on the P38 activation.

To assess the relationship between Sirt2 and p38, we knocked down Sirt2 gene in Neuro-2a or SH-SY5Y cells and found that pP38 was obviously activated after abating the expression of Sirt2, which was in consistent with the effect of AK-7 inhibiting Sirt2 enzyme activity (Figure 3B). It is reported that acetylated P38 can increase the affinity for ATP and enhances kinase activity and be deacetylated by HDAC3 (Pillai et al., 2011). A possible hypothesis is that P38 might also be a potential substrate of Sirt2, and its enhanced activity may be due to the sustained

acetylation through abolishing the Sirt2 activity by AK-7 or specific shRNA. Moreover, we propose that AK-7 protects the brain from occlusion injury as aspects to neurological function, and decreases the infarction volume relying on the p38 activation. The possible mechanism might be that the immediate response of pP38 after ischemia reperfusion injury could directly or indirectly phosphorylates Sirt2 and reduces its catalytic activity to relieve the acute ischemia injury by retarding the cholesterol biosynthesis (Pandithageet al., 2008, Taylor et al., 2011). Another possibility is that the phosphorylated Sirt2 modified by pP38 might be very beneficial for AK-7 compound docking at the molecular structure of Sirt2 and exerting the inhibitor function. To our knowledge, the present study was the first to discover this finding illustrating the involvement of the MAPK pathways in pP38 activation act as a beneficial factor in ischemia stroke.

As illustrated previously, the activation of P38 after the application of AK-7 had been confirmed in vitro that meant AK-7 was able to activate P38 of ischemic stress. In other words, the involvement of P38 in mice with MCAO was not only caused by the effects of ischemic stress, but also by the promoted activity of AK-7, which was consistent with the results of the animal experiment with increasing AK-7 doses administered to mice by intraperitoneal injection (Figure 3C). In conclusion, AK-7 can activate the protective effect of P38 from acute cerebral ischemia with clinical significance and neuroprotective effect of AK-7 is P38 activation-dependent in mice. Agents with a potential to up-regulate pP38 activities may contribute to modifications of the neurological functions. Thus, our study proposed a valuable new perspective in clinical treatment of stroke, especially relating the research and development of new drugs.

Conflicts of interest

All authors declare that they have no potential conflicts of interests.

Author contributions

M.X. and X.L. conceived the study. D.W., W.L., M.X., and X.L. contributed to

experimental design, analysis of data and writing of the manuscript. D.W. and W.L. performed the MCAO model and the Western blot studies and Z.W. performed the TTC staining study. D.W., W.L., and Z.W. Ralimetinib performed the mice behavior test. All authors read and approved the final manuscript.

Acknowledgements

This work was supported by: grants from National Nature Science Foundation of China (grant number 81672708) to M.X.; from Science Foundation of Shanghai 9th People’s Hospital (grant number syzrc2014-002 and syz2015-005) to M.X.

References

Ankolekar S, Rewell S, Howells DW, Bath PM (2012) The influence of stroke risk factors and comorbidities on assessment of stroke therapies in humans and animals. International journal of stroke: official journal of the International Stroke Society 7:386-397.
Bederson JB, Pitts LH, Tsuji M, Nishimura MC, Davis RL, Bartkowski H (1986) Rat middle cerebral artery occlusion: evaluation of the model and development of a neurologic examination. Stroke; a journal of cerebral circulation 17:472-476.
Biella G, Fusco F, Nardo E, Bernocchi O, Colombo A, Lichtenthaler SF, Forloni G, Albani D (2016) Sirtuin 2 Inhibition Improves Cognitive Performance and Acts on Amyloid-beta Protein Precursor Processing in Two Alzheimer’s Disease Mouse Models. Journal of Alzheimer’s disease : JAD 53:1193-1207.
Blander G, Guarente L (2004) The Sir2 family of protein deacetylases. Annual review of biochemistry 73:417-435.
Borlongan CV, Sanberg PR (1995) Elevated body swing test: a new behavioral parameter for rats with 6-hydroxydopamine-induced hemiparkinsonism. The Journal of neuroscience: the official journal of the Society for Neuroscience 15:5372-5378.
Bouët V, Freret T, Toutain J, Divoux D, Boulouard M, Schumann-Bard P (2007) Sensorimotor and cognitive deficits after transient middle cerebral artery occlusion in the mouse. Experimental Neurology 203:555-567.
Calloni RL, Winkler BC, Ricci G, Poletto MG, Homero WM, Serafini EP, Corleta OC (2010) Transient middle cerebral artery occlusion in rats as an experimental model of brain ischemia. Acta cirurgica brasileira 25:428-433.
Chen H, Wu D, Ding X, Ying W (2015a) SIRT2 is required for lipopolysaccharide-induced activation of BV2 microglia. Neuroreport 26:88-93.
Chen X, Wales P, Quinti L, Zuo F, Moniot S, Herisson F, Rauf NA, Wang H, Silverman RB, Ayata C, Maxwell MM, Steegborn C, Schwarzschild MA, Outeiro TF, Kazantsev AG (2015b) The sirtuin-2 inhibitor AK7 is neuroprotective in models of Parkinson’s disease but not amyotrophic lateral sclerosis and cerebral ischemia. PloS one 10:e0116919.
Chopra V, Quinti L, Kim J, Vollor L, Narayanan KL, Edgerly C, Cipicchio PM, Lauver MA, Choi SH, Silverman RB, Ferrante RJ, Hersch S, Kazantsev AG (2012) The sirtuin 2 inhibitor

AK-7 is neuroprotective in Huntington’s disease mouse models. Cell reports 2:1492-1497. del Zoppo GJ (1990) An open, multicenter trial of recombinant tissue plasminogen activator in
acute stroke. A progress report. The rt-PA Acute Stroke Study Group. Stroke; a journal of cerebral circulation 21:Iv174-175.
Egelhof T, Essig M, von Kummer R, Dorfler A, Winter R, Sartor K (1998) [Acute ischemic cerebral infarct: prospective serial observations by magnetic resonance imaging]. RoFo : Fortschritte auf dem Gebiete der Rontgenstrahlen und der Nuklearmedizin 168:222-227.
Feeney DM, Gonzalez A, Law WA (1982) Amphetamine, haloperidol, and experience interact to affect rate of recovery after motor cortex injury. Science (New York, NY) 217:855-857.
Feigin VL, Krishnamurthi RV, Parmar P, Norrving B, Mensah GA, Bennett DA, Barker-Collo S, Moran AE, Sacco RL, Truelsen T, Davis S, Pandian JD, Naghavi M, ForouzanfarMH, Nguyen G, Johnson CO, Vos T, Meretoja A, Murray CJL and Roth GA (2015) Update on theGlobal Burden of Ischemic and Hemorrhagic Stroke in 1990-2013: The GBD 2013 Study.Neuroepidemiology45:161-176.
Gralla J, Schroth G, Remonda L, Nedeltchev K, Slotboom J, Brekenfeld C (2006) Mechanical thrombectomy for acute ischemic stroke: thrombus-device interaction, efficiency, and complications in vivo. Stroke; a journal of cerebral circulation 37:3019-3024.
Grotta JC, Welch KM, Fagan SC, Lu M, Frankel MR, Brott T, Levine SR, Lyden PD (2001) Clinical deterioration following improvement in the NINDS rt-PA Stroke Trial. Stroke; a journal of cerebral circulation 32:661-668.
Guo G, Yang Y, Yang W (2012) Validation of hyperintense middle cerebral artery sign in acute ischemic stroke: Comparison between magnetic resonance imaging and angiography. Neural regeneration research 7:229-234.
Hamann GF (1997) [Acute cerebral infarct: physiopathology and modern therapeutic concepts].
Der Radiologe 37:843-852.
Hara H, Huang PL, Panahian N, Fishman MC, Moskowitz MA (1996) Reduced brain edema and infarction volume in mice lacking the neuronal isoform of nitric oxide synthase after transient MCA occlusion. Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism 16:605-611.
Hattori K, Lee H, Hurn PD, Crain BJ, Traystman RJ, DeVries AC (2000) Cognitive deficits after focal cerebral ischemia in mice. Stroke; a journal of cerebral circulation 31:1939-1944.
IMS Study Investigators (2006) Hemorrhage in the Interventional Management of Stroke study.
Stroke : a journal of cerebral circulation 37:847-851.
Ingberg E, Gudjonsdottir J, Theodorsson E, Theodorsson A, Strom JO (2015) Elevated body swing test after focal cerebral ischemia in rodents: methodological considerations. BMC neuroscience 16:50.
Kent DM, Selker HP, Ruthazer R, Bluhmki E, Hacke W (2006) Can multivariable risk-benefit profiling be used to select treatment-favorable patients for thrombolysis in stroke in the 3- to 6-hour time window? Stroke; a journal of cerebral circulation 37:2963-2969.
Krey L, Luhder F, Kusch K, Czech-Zechmeister B, Konnecke B, Outeiro TF, Trendelenburg G (2015) Knockout of silent information regulator 2 (SIRT2) preserves neurological function after experimental stroke in mice. Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism 35:2080-2088.
Lalaoui N, Hanggi K, Brumatti G, Chau D, Nguyen NY, Vasilikos L, Spilgies LM, Heckmann DA,

Ma C, Ghisi M, Salmon JM, Matthews GM, de Valle E, Moujalled DM, Menon MB, Spall SK, Glaser SP, Richmond J, Lock RB, Condon SM, Gugasyan R, Gaestel M, Guthridge M, Johnstone RW, Munoz L, Wei A, Ekert PG, Vaux DL, Wong WW, Silke J (2016) Targeting p38 or MK2 Enhances the Anti-Leukemic Activity of Smac-Mimetics. Cancer cell 29:145-158.
Lee TY, Murphy BD, Aviv RI, Fox AJ, Black SE, Sahlas DJ, Symons S, Lee DH, Pelz D, Gulka IB, Chan R, Beletsky V, Hachinski V, Hogan MJ, Goyal M, Demchuk AM, Coutts SB (2006) Cerebral blood flow threshold of ischemic penumbra and infarct core in acute ischemic stroke: a systematic review. Stroke 37:2201; author reply 2203.
Li J, Zeng Z, Viollet B, Ronnett GV, McCullough LD (2007) Neuroprotective effects of adenosine monophosphate-activated protein kinase inhibition and gene deletion in stroke. Stroke; a journal of cerebral circulation 38:2992-2999.
Li Y, Nie H, Wu D, Zhang J, Wei X, Ying W (2013) Poly(ADP-ribose) polymerase mediates both cell death and ATP decreases in SIRT2 inhibitor AGK2-treated microglial BV2 cells. Neuroscience letters 544:36-40.
Liu T, Zhang T, Yu H, Shen H, Xia W (2014) Adjudin protects against cerebral ischemia reperfusion injury by inhibition of neuroinflammation and blood-brain barrier disruption. Journal of neuroinflammation 11:107.
Luthi-Carter R, Taylor DM, Pallos J, Lambert E, Amore A, Parker A, Moffitt H, Smith DL, Runne H, Gokce O, Kuhn A, Xiang Z, Maxwell MM, Reeves SA, Bates GP, Neri C, Thompson LM, Marsh JL, Kazantsev AG (2010) SIRT2 inhibition achieves neuroprotection by decreasing sterol biosynthesis. Proceedings of the National Academy of Sciences of the United States of America 107:7927-7932.
Matsuura K, Kabuto H, Makino H, Ogawa N (1997) Pole test is a useful method for evaluating the mouse movement disorder caused by striatal dopamine depletion. Journal of neuroscience methods 73:45-48.
Maysami S, Haley MJ, Gorenkova N, Krishnan S, McColl BW, Lawrence CB (2015) Prolonged diet-induced obesity in mice modifies the inflammatory response and leads to worse outcome after stroke. Journal of neuroinflammation 12:140.
Neuhaus AA, Rabie T, Sutherland BA, Papadakis M, Hadley G, Cai R, Buchan AM (2014) Importance of preclinical research in the development of neuroprotective strategies for ischemic stroke. JAMA neurology 71:634-639.
Nezu T, Koga M, Nakagawara J, Shiokawa Y, Yamagami H, Furui E, Kimura K, Hasegawa Y, Okada Y, Okuda S, Kario K, Naganuma M, Maeda K, Minematsu K, Toyoda K (2011) Early ischemic change on CT versus diffusion-weighted imaging for patients with stroke receiving intravenous recombinant tissue-type plasminogen activator therapy: stroke acute management with urgent risk-factor assessment and improvement (SAMURAI) rt-PA registry. Stroke; a journal of cerebral circulation 42:2196-2200.
Ng M, Fleming T, Robinson M, Thomson B, Graetz N, Margono C, Mullany EC, BiryukovS, Abbafati C, Abera SF, Abraham JP, Abu-Rmeileh NME, Achoki T, Albuhairan FS, AlemuZA, Alfonso R, Ali MK, Ali R, Guzman NA, Ammar W, Anwari P, Banerjee A, Barquera S,Basu S, Bennett DA, Bhutta Z, Blore J, Cabral N, Nonato IC, Chang JC, Chowdhury R,Courville KJ, Criqui MH, Cundiff DK, Dabhadkar KC, Dandona L, Davis A, Dayama A,Dharmaratne SD, Ding EL, Durrani AM, Esteghamati A, Farzadfar F, Fay DFJ,

Feigin VL,Flaxman A, Forouzanfar MH, Goto A, Green MA, Gupta R, Hafezi-Nejad N, Hankey GJ,Harewood HC, Havmoeller R, Hay S, Hernandez L, Husseini A, Idrisov BT, Ikeda N, IslamiF, Jahangir E, Jassal SK, Jee SH, Jeffreys M, Jonas JB, Kabagambe EK, Khalifa SEAH,Kengne AP, Khader YS, Khang YH, Kim D, Kimokoti RW, Kinge JM, Kokubo Y, Kosen S,Kwan G, Lai T, Leinsalu M, Li Y, Liang X, Liu S, Logroscino G, Lotufo PA, Lu Y, Ma J,Mainoo NK, Mensah GA, Merriman TR, Mokdad AH, Moschandreas J, Naghavi M, NaheedA, Nand D, Narayan KMV, Nelson EL, Neuhouser ML, Nisar MI, Ohkubo T, Oti SO,Pedroza A, Prabhakaran D, Roy N, Sampson U, Seo H, Sepanlou SG, Shibuya K, Shiri R,Shiue I, Singh GM, Singh JA, Skirbekk V, Stapelberg NJC, Sturua L, Sykes BL, Tobias M, Tran BX, Trasande L, Toyoshima H, Van De Vijver S, Vasankari TJ, Veerman JL, VelasquezMelendez G, Vlassov VV, Vollset SE, Vos T, Wang C, Wang X, Weiderpass E, Werdecker A, Wright JL, Yang YC, Yatsuya H, Yoon J, Yoon SJ, Zhao Y, Zhou M, Zhu S, Lopez ADMurray CJL and Gakidou E. Global, regional, and national prevalence of overweight andobesity in children and adults during 1980-2013(2014) A systematic analysis for the GlobalBurden of Disease Study 2013. The Lancet384:766-781.
Nguyen DA, Montezano AC, Burger D, Touyz RM (2013)Angiotensin II, NADPH oxidase, and
redox signaling in the vasculature. Antioxid. Redox Signal19: 1110–1120.
North BJ, Marshall BL, Borra MT, Denu JM, Verdin E (2003) The human Sir2 ortholog, SIRT2, is an NAD+-dependent tubulin deacetylase. Molecular cell 11:437-444.
Ogawa N, Hirose Y, Ohara S, Ono T, Watanabe Y (1985) A simple quantitative bradykinesia test in MPTP-treated mice. Research communications in chemical pathology and pharmacology 50:435-441.
Pandithage R, Lilischkis R, Harting K, Wolf A, Jedamzik B, Luscher-Firzlaff J, Vervoorts J, Lasonder E, Kremmer E, Knoll B, Luscher B (2008) The regulation of SIRT2 function by cyclin-dependent kinases affects cell motility. The Journal of cell biology 180:915-929.
Pereira VM, Gralla J, Davalos A, Bonafe A, Castano C, Chapot R, Liebeskind DS, Nogueira RG, Arnold M, Sztajzel R, Liebig T, Goyal M, Besselmann M, Moreno A, Schroth G (2013) Prospective, multicenter, single-arm study of mechanical thrombectomy using Solitaire Flow Restoration in acute ischemic stroke. Stroke; a journal of cerebral circulation 44:2802-2807.
Pillai VB, Sundaresan NR, Samant SA, Wolfgeher D, Trivedi CM, Gupta MP (2011) Acetylation of a conserved lysine residue in the ATP binding pocket of p38 augments its kinase activity during hypertrophy of cardiomyocytes. Molecular and cellular biology 31:2349-2363.
Saqqur M, Molina CA, Salam A, Siddiqui M, Ribo M, Uchino K, Calleja S, Garami Z, Khan K, Akhtar N, O’Rourke F, Shuaib A, Demchuk AM, Alexandrov AV (2007) Clinical deterioration after intravenous recombinant tissue plasminogen activator treatment: a multicenter transcranial Doppler study. Stroke; a journal of cerebral circulation 38:69-74.
Shi ZS, Loh Y, Walker G, Duckwiler GR (2010) Clinical outcomes in middle cerebral artery trunk occlusions versus secondary division occlusions after mechanical thrombectomy: pooled analysis of the Mechanical Embolus Removal in Cerebral Ischemia (MERCI) and Multi MERCI trials. Stroke; a journal of cerebral circulation 41:953-960.
Takata K, Yamauchi H, Tatsuno H, Hashimoto K, Abo M (2006) Is the ipsilateral cortex surrounding the lesion or the non-injured contralateral cortex important for motor recovery in rats with photochemically induced cortical lesions? European neurology 56:106-112.
Taylor DM, Balabadra U, Xiang Z, Woodman B, Meade S, Amore A, Maxwell MM, Reeves S, Bates GP, Luthi-Carter R, Lowden PA, Kazantsev AG (2011) A brain-permeable small molecule reduces neuronal cholesterol by inhibiting activity of sirtuin 2 deacetylase. ACS chemical biology 6:540-546.
Tesio M, Tang Y, Mudder K, Saini M, von Paleske L, Macintyre E, Pasparakis M, Waisman A, Trumpp A (2015) Hematopoietic stem cell quiescence and function are controlled by the CYLD-TRAF2-p38MAPK pathway. The Journal of experimental medicine 212:525-538.
Verma R, Friedler BD, Harris NM, McCullough LD (2014) Pair housing reverses post-stroke depressive behavior in mice. Behavioural brain research 269:155-163.
Yang C, Yen T, Hsu C, Thomas PA, Sheu J, and Jayakumar T (2017) Multi-Targeting Andrographolide, a Novel NF-κB Inhibitor, as a Potential Therapeutic Agent for Stroke. International Journal of Molecular Sciences18 (8): 1638.
Yoshimoto Y, Kwak S (1995) Superficial temporal artery–middle cerebral artery anastomosis for acute cerebral ischemia: the effect of small augmentation of blood flow. Acta neurochirurgica 137:128-137, discussion 137.
Yuan F, Xu ZM, Lu LY, Nie H, Ding J, Ying WH, Tian HL (2016) SIRT2 inhibition exacerbates neuroinflammation and blood-brain barrier disruption in experimental traumatic brain injury by enhancing NF-kappaB p65 acetylation and activation. Journal of neurochemistry 136:581-593.
Zhang L, Schallert T, Zhang ZG, Jiang Q, Arniego P, Li Q, Lu M, Chopp M (2002) A test for detecting long-term sensorimotor dysfunction in the mouse after focal cerebral ischemia. Journal of neuroscience methods 117:207-214.

Figure legends

Figure.1 The P38 signal was specifically activated after acute focal cerebral ischemia in mice.
(A) TTC staining of the fields of ischemic infarction of the striatum and the ischemic area of the cortex in brain. (B) Immunoblot for detecting the expression level of cell signaling molecules in the brain ischemic injury area in comparison to the normal area. The Phospho-p38 MAPK (Thr180/Tyr182) (D3F9) mouse mAb was used for pP38 detection, and three representative western-blot detections were showed. (C) The relative expression ratios of pP38 were calculated according to the Image J software analysis and qualified as columns with total 6 brain tissue samples. Triple asterisk indicates the very significant difference (p < 0.001).

Figure.2 AK-7 attenuates the ischemic injury and preserves the neurological function in the MCAO model. (A) The infarction volume was remarkably reduced in AK-7 treated groups in a concentration dependent manner according to TTC staining assay. The representative images were shown in the left panel. The infarction volumes from no less than 8 mice of each group were qualified as columns in the right panel. (B-F) Behavior tests were examined in the third day after MCAO with 5 behavior test methods, including Elevated body swing test (B), pole test (C), corner test (D), neurological score (E) and beam balance test (F). Behavior tests showed that AK-7 could significantly improve mice paralysis both in a manner of concentration dependent manner. Triple

asterisk indicates the very significant difference (p < 0.001).

Figure.3 AK-7 can activate the pP38 activity in vitro and in vivo. (A) Neuro-2a cells treated with AK-7 at a gradient concentration were harvested after 48h and lysed for SDS-PAGE and immunoblot assay. The Phospho-p38 MAPK (Thr180/Tyr182) (28B10) mouse mAb was used for pP38 detection. (B) Neuro-2a or SH-SY5Y cells infected by lentiviral with control or expressing Sirt2 shRNA were lysed for SDS-PAGE and immunoblot analysis. (C) Immunoblot for detecting the pP38 activity in the normal or ischemic striatum of mice underlying administration of AK-7 or AK-7 plus LY2228820. The Phospho-p38 MAPK (Thr180/Tyr182) (D3F9) Rabbit mAb was used for pP38 detection (upper panel). The relative expression ratios of pP38 were calculated according to the Image J software analysis and qualified as columns with 9 brain tissue samples of each group (lower panel). Triple asterisk indicates the very significant difference (p < 0.001).

Figure.4 The neuroprotective effect of AK-7 depends on the up-regulation of pP38. (A) The infarction volume was remarkably decreased in AK-7 treated group, but AK-7 lost the protective effects combining with pP38 inhibitor according to TTC staining assay. The representative images were shown in the left panel. The infarction volumes from no less than 9 mice of each group were qualified as columns in the right panel. (B-F) Elevated body swing test (B) and pole test (C) showed LY2228820 resistant to the protection of AK-7 in neuroethology, but the inhibitor did not significantly affect the AK-7 protective effects in corner test (D), beam balance test (E) and neurological score (F).Triple asterisk indicates the very significant difference (p < 0.001).

150 31 119 63
Sham vehicle 16 0 16 0 10
AK-7 (0 mg/kg) 44 12 32 27.27% 17

MCAO AK-7 (10 mg/kg) 24 6 18 25.00% 8
AK-7 (20 mg/kg) 42 8 34 19.05% 19
AK-7 + LY2228820 (20 mg/kg each) 24 5 19 20.83% 9

Highlights

•pP38 signal is specifically activated after ischemia reperfusion in mice
•AK-7 can relieve the ischemic injury and possesses neuroprotective effect.
•AK-7 is able to enhance the pP38 activation level in vitro and in vivo.
•pP38 activation is required for AK-7 exerting neuroprotective function.
•AK-7 can be a possible therapeutic drug for acute cerebral ischemia.